Table 2

Primer sequences

Primer5′–3′ sequencea
P4773FBamHICCGGATCCGTATCCACCAGCCGTACCTG
P4775RBamHICCGGATCCTCAGTGATTCCACAATTCCC
PA3552rtFGTAGCGGCATCCATTTCATC
PA3552rtRCATCGACGTTTCTCCAGGAT
PA4773rtFCAGTGGATCGAGGAAAGCAT
PA4773rtRGTACTCCGGCCAGGTATGG
PA4774rtFTTCTACGAGCTGCTGCATTC
PA4774rtRGACCTGGGAGAAGACACTGC
PA4775rtFGTACCGCTGGCCGTCAAC
PA4775rtRGTCTTCGCTCAGCTCGATG
pmrArtFCACCAGGTGACCCTGTCC
pmrArtRCGTAGAGGCTCTGCTCCAGT
proCrtFCAGGCCGGGCAGTTGCTGTC
proCrtRGGTCAGGCGCGAGGCTGTCT
  • a Restriction sites are underlined.