Table 3

Primers used in this study

Primer designationPrimer sequence (5′–3′)
P1GCTAGAATTCTGACATAAGGTAGGTG
P2AAAGGATCCTCACCACGGGATAAACTGG
P3GTGGTGTTGGCTGCCTTGCTGCTTTGGGC
P4GCCCAAAGCAGCAAGGCAGCCAACACCAC
P5CGCAGGTATTCAACATGATGGCCGATCAGGATGTACAATTTTTCAGC
P6GCTGAAAAATTGTACATCCTGATCGGCCATCATGTTGAATACCTGCG
P7GGATGTACAATTTTTCAGCGGAATTGCTGCCATTAACCAGTTTATCCC
P8GGGATAAACTGGTTAATGGCAGCAATTCCGCTGAAAAATTGTACATCC
P9ATACCATGGGTCACCATCACCACCATCACATGAAAAAGTTTCGATGGGTCGTTCTGGTTGTCGTGG
P10CATCCGCCAAAACAGCCAAG
P11GACACAGGAACACTTAACGGC
P12GAGCATTACGCTGACTTGAC