Table 2

Primers designed and used in this study

Primer function and nameSequence (5′–3′)
ccpA cloning
    Forward primerGCGCGGATCCATAGGAGAAGAAACATGG
    Reverse primerCCGGCTCGAGTTATTTTGTTGAACC
ccpA deletion
    ccpAFlank1FCGGAATTCCGCCATTCATCACCAATTTTGATGGC
    ccpAFlank1RGCCGTGTCAATGCGCTTAT'
    ccpAFlank2FCTTTGTCATTAGTTTTGTTAATAAGCGCATTGACACGGCGACAACACGAGAAACAGTAGCC
    ccpAFlank2RGCTCTAGAGCCGGTTGACTGATGGCCTC
    ccpAUpFATAAGCGCATTGACACGGC
    ccpAdownRCTGTTTCTCGTGTTGTCAATGGTA
    ccpAOuterFCAAGATGTTCTTTCGGCGTCA
    ccpAOuterRGTGTGCCTTGTGTTCGT
ace qRT-PCR set 1
    Forward primerAACAGCAACGGCGACTCAAC
    Reverse primerAACGGATAGTCTCGCTCAATTTG
ace qRT-PCR set 2
    Forward primerGGCAACGAGAACTTCCCAAA
    Reverse primerACACCTAAAACGGCAAATGTACTTG
gelE qRT-PCR set
    Forward primerCTAATCCAGAAATTGGTGCGGA
    Reverse primerAGCCATGGTTTCTGGTTGTCC
gyrB qRT-PCR
    Forward primerACCAACACCGTGCAAGCC
    Reverse primerCAAGCCAAAACAGGTCGCC
srtA qRT-PCR set
    Forward primerATTGATGACGTTCCTGGTCA
    Reverse primerTTTAATAGGCGTCGTTGCTG