Table 2

Properties of oligonucleotides

NameSequence (5′–3′)aSize (bp)
PG0032F1ACACCTTCCGAACATTTCTCC
PG0032R1(SstI)atatatgagctcGTCCGTTCGGGCTGTACAG785
PG0032F2 (XbaI)atatattctagaGCCAAACCCTACTGCATGG
PG0032R2GTGTCGCAGACGAATAGCC680
PG0902F1TTTCTCCCCTACCCCATAGC
PG0902R1 (SstI)atatatgagctcTGCGTCGTATCGTTATTGGC700
PG0902F2 (XbaI)atatattctagaATCACAGAGAGTAATGCATGGC
PG0902R2ACCAGCAATGTCCCTCGC609
PG0973F1TGACGATCCGAAACTTCCTC
PG0973R1 (SstI)atatatgagctcGCCGACTCACCYGAAGTACG671
PG0973F2 (XbaI)atatattctagaTTATGATCCGACCAACGAGC
PG0973R2TCGTAACGGAGGTGACCG434
PG1711F1TCCTCCTTGTGCTAAGCTCTG
PG1711R1 (Sst)atatatgagctcGGCTGGTGTAGAATACCTGTCG839
PG1711F2 (XbaI)atatattctagaATCGCTGGGATGTACAGCAC
PG1711R2ATAGGGATCTGCAGAAGGAGG631
PG1712F1TTCTCTGCTTGTTTGTCGGC
PG1712R1 (SstI)atatatgagctcCTGCCCTTTGACTTCCGC814
PG1712F2 (XbaI)atatattctagaGATAGAGCTGCATTGGACACG
PG1712R2TTACTGTGATTAGCGCGACG841
ErmFF2TTCGTTTTACGGGTCAGCAC2,100
ErmAMR2ACTTTGGCGTGTTTCATTGC
  • a Lowercase letters in boldface indicate restriction enzyme sites, and lowercase letters in lightface indicate irrelevant sequences used to facilitate digestion with restriction enzymes.