Table 2

Primers and probes used in this study

Primer name5′→3′ sequenceaGene(s)
algR-CdgRgn-KpnI-FTATCCGGTACCGTGACTCATGCAGGAAGCCalgR
algR-CdgRgn-HindIII-RCCGCCGAAAGCTTTCAGAGCTGATGCATCAalgR
algRSalIFCCTGTCGACATGAATGTCCTGATTGTCGATGACalgR
algRNotIRAGCCGCGGCCGCTCAGAGCTGATGCATCAGACGalgR
algR-D54E-XbaI-FCTTCTAGAAATCCGCATGCCCGGalgR
algR-D54E-XbaI-RCGGATTTCTAGAAGGACGATATCalgR
fimU TF XbaICATGGTCTAGAGGTCGCAGAGAGCfimU
fimU TFR HindIIICTCCAAGCTTTCTACGCCTGGfimU
fimU gs frag FGGGGTCTACGCCTGGAAAGCfimU
fimU gs frag RGTTGTCCTGCCCCTCGGGCCGfimU
pscF GS ContFAAGGCGGTCTCGGCATTCTTTCpscEF
pscF GS Cont R93CCACGGTATCGAGGGTATTCpscEF
rhlA TF BamHI FGGACGGATCCCATGACCATCAAATCGrhlA
rhlA TF PstI RCGAACCTGCAGACAGCTATCGCTrhlA
rhlA qRT FTTTCACATCGACCAGGTGCrhlA
rhlA qRT RCGAGACCGTCGGCAAATACrhlA
rhlA qRT probe56-FAM-ATGTGCTGA-ZEN-TGGTTGCTGGCTTTC-3IABKFQrhlA
rpoD qRT FGGGCGAAGAAGGAAATGGTCrpoD
rpoD qRT RCAGGTGGCGTAGGTGGAGAArpoD
rpoD qRT probe56-FAM-TGAAGGCGG-ZEN-TGGACAAGTTCGAAT-3IABKFQrpoD
rhlA gs frag 1FGATTCGCGATCATTTTTCGCAGCTrhlA
rhlA gs frag 1RCACGTCGTAGCCGTAGCTGGACACrhlA
rhlA gs frag 2FGTGTCCAGCTACGGCTACGACGrhlA
rhlA gs frag 2RGTTCGGCGGGATGATGCAGACGTCGrhlA
rhlA gs frag 3FCGACGTCTGCATCATCCCGCCGAACrhlA
rhlA gs frag 3RCGTAGATCTTCGCCGGCAGGTTGrhlA
rhlA gs frag 4FCCAACCTGCCGGCGAAGATCTACGrhlA
rhlA gs frag 4RGTTTCCGGTGTCGAAACGCTCTGrhlA
rhlA gs frag 5FCAGAGCGTTTCGACACCGGAAACrhlA
rhlA gs frag 5RCAAACGATTGGCGTCCGTGTTCACGrhlA
rhlA gs frag 6FCGTGAACACGGACGCCAATCGTTTGrhlA
rhlA gs frag 6RCGCGCCGCATTTCACACCTCCCrhlA
rhlA SDM WT RB1 FGCATGATCGAGCCGTTCGTCGAGCGCCAGrhlA
rhlA SDM delta RB1 FGCATGATCGAGCCATTTGTAGAGCGCCAGrhlA
rhlA SDM WT RB2 RCTCGATCATGCCGTGCTCCTGAGCCATGCrhlA
rhlA SDM delta RB2 RCTCGATCATTCCATGTTCTTGAGCCATGCrhlA
rhlAB EcoRI FGAGGAATTCGATGCGGCGCGAAAGTCrhlAB
rhlAB HindIII RCAAGCTTTCAGGACGCAGCCTTCAGCrhlAB
  • a 56-FAM, 5(6)-carboxyfluorescein; 3IABKFQ, 3′ Iowa Black FQ.