Table 2

Oligonucleotide primers used in this study

PrimerSequence (5′→3′)aConstruct(s) or use
fliL30aEBS1dCAGATTGTACAAATGTGGTGATAACAGATAAGTCGCTATAGCTAACTTACCTTTCTTTGTYL1003
fliL30aEBS2TGAACGCAAGTTTCTAATTTCGATTTAATTTCGATAGAGGAAAGTGTCTYL1003
fliL30aIBSAAAAAAGCTTATAATTATCCTTAAATTACGCTATAGTGCGCCCAGATAGGGTGYL1003
3101-166aEBS1dCAGATTGTACAAATGTGGTGATAACAGATAAGTCATCTTTTATAACTTACCTTTCTTTGTYL1005
3101-166aEBS2TGAACGCAAGTTTCTAATTTCGATTTAACTTCGATAGAGGAAAGTGTCTYL1005
3101-166aIBSAAAAAAGCTTATAATTATCCTTAAGTTACATCTTTGTGCGCCCAGATAGGGTGYL1005
fliLpFGGATCCGTGGTGTCGATATTTSequencing
fliLRAGCGTAACGTGATCCCTATGSequencing
fliLp-BamHI_fCTTGGATCCGTGGTGTCGATATTTTTGpYL30
fliL-HindIII_rCGGAAGCTTATCGCTCATAATGATTATCpYL30, pYL35, pYL64
fliLup-BglI_f2AATGCCTCCTCGGCTCAATTACATCTTGCCTCTCpYL47
fliR-SalI_rCACGTCGACTCAAGAAACTAATTGCTGCAApYL47
pACYC184-HindIII_rCTACCGCATTAAAGCTTATCGATGpYL61, pYL62, pYL63, pYL64
fliO-HindIII_rACTAAGCTTTTATGAGTTGCCTTTATCTCGCpYL61
fliN-HindIII_rATTAAGCTTTCAACGACTCAGACGGCGpYL62
fliM-HindIII_rATTAAGCTTTCACTCATTGGTTTGTTCCTCpYL63
fliL-NcoI_fATCCCATGGCTAATTACAGCAATGAACGTAApYL35
SacI-SD-fliL_fCAAGAGCTCCACTACAAAACAGGAATTTpYL36, pYL37
fliL-KpnI_rCTTGGTACCTTATCGCTCATAATGATTATCpYL36, pYL37
3101CO-SacI_fCGGGAGCTCGGGTGATTATGCTGAAGATAATATGpYL42
3101CO-SmaI_rCCGCCCGGGAAATATAGTGTTATTTAATACTCTGpYL42
fliLp-SmaI_fTTTCCCGGGGTGGTGTCGATATTTTTGCCpYL42
fliL-EcoRI_rCCGGAATTCTTATCGCTCATAATGATTATCpYL42
flaApFGGATCCACTGGTCTCCTTTCTpYL70
flaApEcoRI_rAACGAATTCAGCTAGATTCCTTTAAAApYL70
lacZ-HindIII_rTGATAAGCTTTTATTTTTGACACCAGACCAACTGGpYL70
fliL_rGAGCATCTATCTCTGCCTGTGAAAGG-3'qRT-PCR
flhDFAAGGCTTCCGCAATGTTTAGACqRT-PCR
flhDRGTTGCAAATCATCCACTCTGGAqRT-PCR
fliAFCCTGCGAGTGTTGAATTGGAqRT-PCR
fliARGGATTGTGTCACTTCTCTTGCqRT-PCR
fliMFGTCAATTCCGTATGGGGCTGqRT-PCR
fliMRAACCAGATTCGGCTCAAAGGqRT-PCR
fliOFCAACCTTTACCCGTTGGACAqRT-PCR
fliORCGACAACACGCTCTTTGGTAqRT-PCR
flaAFCAACTGAAGGTGCATTGAACqRT-PCR
flaARTGATTTCTCACCGCTCAGTAqRT-PCR
  • a Underlining indicates restriction sites for cloning.