Table 2

Primers used in this study

Primer nameSequence
EBS UniversalCGAAATTAGAAACTTGCGTTCAGTAAAC
oLB64AAAAGCTTTTGCAACCCACGTCGATCGTGAATTCTGCAGCTAAGTGCGCCCAGATAGGGTG
oLB65CAGATTGTACAAATGTGGTGATAACAGATAAGTCAGCTAATTTAACTTACCTTTCTTTGT
oLB66CGCAAGTTTCTAATTTCGGTTCAGAATCGATAGAGGAAAGTGTCT
oLB67AAAAGCTTTTGCAACCCACGTCGATCGTGAAGACCCAAGTAAAGTGCGCCCAGATAGGGTG
oLB78TCCTCCAGTTTGGACTCCTGTAAC
oLB79ATTGGAACTAATGGAGCAACTG
oLB99AAAAGCTTTTGCAACCCACGTCGATCGTGAACAGTTACTGTTTGTGCGCCCAGATAGGGTG
oLB100CAGATTGTACAAATGTGGTGATAACAGATAAGTCCTGTTTCGTAACTTACCTTTCTTTGT
oLB101CGCAAGTTTCTAATTTCGGTTAACTGTCGATAGAGGAAAGTGTCT
oLB102AAAAGCTTTTGCAACCCACGTCGATCGTGAAATGTATCATTTAGTGCGCCCAGATAGGGTG
oLB103CAGATTGTACAAATGTGGTGATAACAGATAAGTCCATTTACTTAACTTACCTTTCTTTGT
oLB104CGCAAGTTTCTAATTTCGGTTTACATTCGATAGAGGAAAGTGTCT
oLB118ATAATAGGTGACCGTGATGG
oLB119TTCTTCTCTTATACCAGACATTTC
oLB120ATAGGGATTCTTCCTGTTCTTAG
oLB121TCCTATGTCTTCTTTTCTCTCTCT
oLB122CTAGCTGCTCCTATGTCTCACATC
oLB123CCAGTCTCTCCTGGATCAACTA
oLB131GTATGGATAGGTGGAGAAGTCA
oLB132CTCTTCCTCTAGTAGCTGTAATGC
oLB261CTATAGACTCTCATACAGCAGGTG
oLB262CATTATGTCCTCTTGGCTCTAAC
oLB265GGGAGAGGGTATTACACATACT
oLB266GGAGTTCCATATCTCCCAAATACC
oLB170GGTCAAGTACTAGGAGCTAAGT
oLB171CTACTTCTTCTTTAGCCTCTCCTG
oLB176CCCTGGTATCATGTCTAAAGTTG
oLB177GAGTATACTTAGCTCCTTCTCCAG
oLB187CCCGAATTCTGGATACAGGCATTCATTAATTGT
oLB188CCCAAGCTTAACACATCTATATACACAACAC
oLB221GAACTCTAATCGCAGAACCAAC
oLB222CATTCCTACTACTCCAGCTTCT
oLB277GTAGGAGAACCTATGGGAAC
oLB278TCCTTACCATTTAAGCACAC