TABLE 1

Bacterial strains, plasmids, and oligonucleotides used in this study

Strain, plasmid, or oligonucleotideDescription or sequence (5′–3′)aReference or source
Strains
    C. jejuni DRH212Streptomycin-resistant C. jejuni 81-176 (Smr)10
    C. jejuni ΔrpoNrpoN deletion mutant of C. jejuni DRH212 (Smr)10
    C. jejuni kpsM::kankpsM insertion mutant of C. jejuni 81-17615
    C. jejuni mapA::kanmapA insertion mutant of C. jejuni DRH212 (Knr Smr)This study
    E. coli DH5αE. coli strain used for cloningInvitrogen
Plasmids
    pRY109Campylobacter coli cat cassette plasmid (Cmr Apr)26
    pGEM-T EasySubcloning vector (Apr)Promega
    pKinnickPlasmid containing hawkeye transposon (Cmr Apr)This study
Oligonucleotides
    5′cat_INSeqACGCGTCCTAACAGGTTGGATGATAAGTCCCCGGTCTTCGTATGCCGTCTTCTGCTTGGCGCGCCCTCGAGCAATTGTGCTCGGCGGTGTTCCTTTCCAA
    3′cat_INSeqACGCGTCCTAACAGGTTGGATGATAAGTCCCCGGTCTTCGTATGCCGTCTTCTGCTTGGCGCGCCCTGCAGTCTAGTGCGCCCTTTAGTTCCTAAAGGGT
    JJ17CTAGCGAGCTTCCTCCTGTT
    JJ18CATCTCTTGCGTCAGGCAAA
    JJ19GGATCCCCGCATTAAAATTCACATCAAC
    JJ20GGATCCGCTAGAGGAATAGTTGTGCTT
  • a Apr, ampicillin resistance; Cmr, chloramphenicol resistance; Kmr, kanamycin resistance; Smr, streptomycin resistance.