TABLE 2

Primers used in this study

Category and primer nameSequence (5′ to 3′)a
Construction of suicide plasmid for pflB gene
    EF delta pfl XbaI FGCGTCTAGACGCTTGCATCTAAAAGGTTATGTG
    EF delta pfl HindIII RCTCCAAGCTTGGAGGCTCAATTCCTTCTAATGG
    pHY300PLK tet P (+) SalIFCCGGTCGACCGGGCCATATTGTTGTATAAGTG
    pHY300PLK tet RGCTTCTAGAGATCTGCAGGTCG
Confirmation of pflB gene disruption
    EF delta pfl check FGGGCACACAAGAAGTTATTCAGTC
    EF delta pfl check RGGCATATTGAGTTTCTTCACTTGG
Construction of reporter assay and plasmids
    EF ldhL1 Pro XbaI FAAGTCTAGACTTTCATTCTCCTTGGATTATAAGC
    EF ldhL1 Pro SalI RATGGTCGACCATGTGTACCATTCCTTCCTCTAC
    EF pdhAB Pro XbaI FTGCTCTAGAGCAATGAATGTTCGTGATAAAACC
    EF pdhAB Pro SalI RATGGTCGACCATTTTGTCACACAATCCTCTCTATTACG
    EF pflB Pro XbaI FCCCTCTAGAGGGCACACAAGAAGTTATTCAGTC
    EF pflB Pro SalI RATGGTCGACCATGAAGTGTTTGCCTCCTTAGTT
    EF adhE Pro FGGTTAAGCCGAATGAATTTTTTGAC
    EF adhE Pro SalI RATGGTCGACCATGTTCATCCTCCTAAGAGTTTCATT
    beta-gal SalI FGACGTCGACGTCGTTTTACAACGTCGTGACTG
    beta-gal SD ATG-fuse XbaI FGTTTCTAGAAACTAAGGAGGCAAACACTTCATG
    beta-gal SphI RAGGGCATGCCCTGCCCGGTTATTATTATTTTTGA
RT-PCR
    EF RT-PCR 16S FGTGTCGTTGATGGATGGACC
    EF RT-PCR 16S RTCTACGCATTTCACCGCTACAC
    EF RT-PCR pflA FCCGTTTTATCGTATTTACACAAGGG
    EF RT-PCR pflA RGGCATCCAGACGGATTAAATATTC
    EF RT-PCR pflB FGAGAACAAGCGTTGACACTCG
    EF RT-PCR pflB RCCATATAATGCGATACGACGATAGTC
    EF RT-PCR glpF1 FCGAACAAAATACGCTGGTTCTG
    EF RT-PCR glpF1 RCAAACAAGCAAGCCAACAGC
    EF RT-PCR glpF2 FGGTTGGGTCGTTATTGCTTTAGG
    EF RT-PCR glpF2 RATTGGCTGGATAGTTACGGACAG
  • a Underlined nucleotides indicate restriction sites.