TABLE 2

Primers used for PCR, semiquantitative PCR, and mutant construction

PrimerSequenceAnnealing temp (°C)
hupL7822MF(F1)AGTGACACAAAGACCCACGAC
hupL7822MR(R1)AAGATGGCTATGTGGTCAACG52
rnpBFCGTGAGGATAGTGCCACAGA
rnpBFAAACGGGACCGGTAAAAGAC55
hoxHFGCTGAAGCCGGAATTAACAA
hoxHRATTTGTAGCGGCATTTGTCC53
hupLF2AACGGTAAACCGATCAAACG
hupLR2CGGATGGGTCTTGATATTGG53
nifHFCAACACCAAAGCGCAAGTAA
nifHRGGATAGGCATAGCGAAACCA54
nifDFATTTCCAAGAACGCGACATC
nifDRTCACGAACAGCATCGTTAGC53
psbAFCCCACCCTTCTGACAGCTAC
psbARCTAACTGGTAAGGGCCACCA52
NmKmF(F2)TGCTCCTGCCGAGAAAGTAT
NmKmR(R2)ATTATCACGGGTAGCCAACG53