TABLE 1

E. coli strains, plasmids, and oligonucleotides used in this study

Strain/plasmidConstruction/characteristic(s) or sequenceReference/source
Strain
    MG1655ilvG, rfb-50, thi59
    MG1655StrSmr; ilvG, rfb-50, thi60
    MG1655flhDCMS426, flhDC deletion in MG165561
    MG1655fluMS427, flu deletion in MG165561
    MG1655fimMS428, fim operon deletion in MG165529
    CAUTI1-9E. coli isolates from catheterized of patients with CAUTIThis study
    CAUTI5fimCAUTI5 with TargeTron insertion in fimA, KmrThis study
    CFT073Uropathogenic E. coli62
    CFT073fimCFT073 with TargeTron insertion in fimA, KmrThis study
Plasmid
    pACD4K-CCmr, TargeTron plasmidSigma Aldrich
    pACD4K-CfimpACD4K-C with intron retargeted for insertion in fimAThis study
    pAR1219Ampr, helper plasmid encoding T7 polymeraseSigma Aldrich
    pEpiFos5Cmr, fosmid cloning vector with partitioning systemEpicentre
    pEpiFosfimCmr, pEpiFos5 with fim operon of E. coli MG1655This study
Oligonucleotide
    fimA 10-11s EBS1dCAGATTGTACAAATGTGGTGATAACAGATAAGTCACAGAACGTAACTTACCTTT CTTTGT
    fimA 10-11s EBS2TGAACGCAAGTTTCTAATTTCGGTTCACTTCCGATAGAGGAAAGTGTCT
    fimA 10-11s IBSAAAAAAGCTTATAATTATCCTTAAAGTGCACAGAAGTGCGCCCAGATAGGGTG
    fimIE_FWAGTAATGCTGCTCGTTTTGC
    fimIE_RVGACAGAGCCGACAGAACAAC
    op-K12-fim01TAAGCGGCCGCCATCAGGCTGAGC
    op-K12-fim02ATAGCGGCCGCCGGGATTATCAG