TABLE 3

Primers used in this study

Primer no.NameSequenceDescription
341pssl7-F-PstI5′-CCCC-CTGCAG-GCAGACTAGTAATTGTAGGGPssl7-sGFP reporter
489sGFP-R-BamHI5′-CCC-GGATCC-TTAGTGGTGGTGGTGGTGGPssl7-sGFP reporter
1118Rot-Mut1-F-NdeI5′-CCCCCATATGATGAAAAAAGTAAATAACGACACTGTAGCAGGAATTGCAGCATTAGAAGCACTTTTGGForward primer to make a Rot F10A/L13A/Q14A/T17A mutant; use with primer 311 to clone into pOS1Plgt
1120Rot-Mut3-F5′-CAAAATGGCAAGAGCAGCAATTTTAATTTTACTAACForward SOEing primer to make a Rot S36A/E38A/E39A mutant; use with primer 311
1121Rot-Mut3-R5′-GTTAGTAAAATTAAAATTGCTGCTCTTGCCATTTTGReverse SOEing primer to make a Rot S36A/E38A/E39A mutant; use with primer 313
1122Rot-Mut4-F5′-CTTTATGGGCAAAAGGTTCTATGACForward SOEing primer to make a Rot Q48A mutant; use with primer 311
1123Rot-Mut4-R5′-GTCATAGAACCTTTTGCCCATAAAGReverse SOEing primer to make a Rot Q48A mutant; use with primer 313
1124Rot-Mut5-F5′-GGTTCTATGACGGCAGCAGAAATGGACForward SOEing primer to make a Rot L54A/K55A mutant; use with primer 311
1125Rot-Mut5-R5′-GTCCATTTCTGCTGCCGTCATAGAACCReverse SOEing primer to make a Rot L54A/K55A mutant; use with primer 313
1126Rot-Mut6-F5′-GATTTGTTGAAGCAGCAGCAGCAGCAGCAGCAGCAACGTATAATAATTTAGForward SOEing primer to make a Rot K64A/P65A/Y66A/K67A/R68A/T69A/R70A mutant; use with primer 311
1127Rot-Mut6-R5′-CTAAATTATTATACGTTGCTGCTGCTGCTGCTGCTGCTGCTTCAACAAATCReverse SOEing primer to make a Rot K64A/P65A/Y66A/K67A/R68A/T69A/R70A mutant; use with primer 313
1128Rot-Mut7-F5′-CGAGAGCATATAATGCATTAGTTGAATTAGForward SOEing primer to make a Rot T71A/N74A mutant; use with primer 311
1129Rot-Mut7-R5′-CTAATTCAACTAATGCATTATATGCTCTCGForward SOEing primer to make a Rot T71A/N74A mutant; use with primer 313
1132Rot-Mut9-F5′-GACGATGAAGCAACAGTTATTATTCForward SOEing primer to make a Rot R91A mutant; use with primer 311
1133Rot-Mut9-R5′-GAATAATAACTGTTGCTTCATCGTCReverse SOEing primer to make a Rot R91A mutant; use with primer 313
1137Rot-Mut13-F5′-GAAGAAATTGCAATTTTAGCAACTTTATGGCForward SOEing primer to make a Rot L41A/L44A mutant; use with primer 311
1138Rot-Mut13-R5′-GCCATAAAGTTGCTAAAATTGCAATTTCTTCReverse SOEing primer to make a Rot L41A/L44A mutant; use with primer 313
311rot-6×His–3′-RXhoI5′-CCCCTCGAG-TTAGTGATGGTGATGGTGATG-CACAGCAATAATTGCGTTTAAACReverse primer to clone rot into pOS1-Plgt
313rot5′F-NdeI5′-CCCC-CATATG-AAAAAAGTAAATAACGACACTGForward primer to clone rot downstream of the lgt promoter in the pOS1-Plgt plasmid.
270hla P1-RT5′-AAAAAACTGCTAGTTATTAGAACGAAAGGqRT-PCR analysis of hla
271hla P2-RT5′-GGCCAGGCTAAACCACTTTTGqRT-PCR analysis of hla
27816S P1-RT5′-TGAGATGTTGGGTTAAGTCCCGCAqRT-PCR analysis of 16S rRNA
27916S P2-RT5′-CGGTTTCGCTGCCCTTTGTATTGTqRT-PCR analysis of 16S rRNA
280ssl7 P1-RT5′-AACGTTAGCTAAAGCAACATTGGCqRT-PCR analysis of ssl7
281ssl7 P2-RT5′-TTGCTTGAACTGCTTGGCCTTCTGqRT-PCR analysis of ssl7
290spA1P1-RT5′-CAGCAAACCATGCAGATGCTAqRT-PCR analysis of spa
291spA2P2-RT5′-GCTAATGATAATCCACCAAATACAGTTGqRT-PCR analysis of spa
370lukE-P15′-GAAATGGGGCGTTACTCAAAqRT-PCR analysis of lukE
371lukE-P25′-GAATGGCCAAATCATTCGTTqRT-PCR analysis of lukE
305pssl7-R-BIO5′-BIO-CCCC-AGTACTATTCTCCCAATCTATTTBiotinylated primer for EMSA probe amplification
341pssl7-F5′-CCCC-CTGCAG-GCAGACTAGTAATTGTAGGGEMSA probe amplification
736plukED-F-BIO5′-BIO-AAGTTTCACTTTCTTTCTATATAAATBiotinylated primer for EMSA probe amplification
397plukED-R5′-CCC-CTGCAG-ATCTTCGTTTAACGGACAATAGEMSA probe amplification