TABLE 3

Primers used in this paper

NameSequence (5′→3′)aRestriction site
UreBF1GCTTCGGTACCCCTGAGAGAAGGCATGAGKpnI
UreBR1GCATCGAGCTCCCGGCAACACTTGTCTSacI
UreB:H136AFGTGGTATTGACACAGCTATCCACTTCATTTCAC
UreB:H136ARGTGAAATGAAGTGGATAGCTGTGTCAATACCAC
UreB:H138AFATTGACACACACATCGCCTTCATTTCACCCC
UreB:H138ARGGGGTGAAATGAAGGCCATGTGTGTGTCAAT
UreB:K219AFGGTGCGATTGGCTTTGCAATCCACGAAGACTGG
UreB:K219ARCCAGTCTTCGTGGATTGCAAAGCCAATCGCACC
  • a Primers were purchased from Integrated DNA Technology, Coralville, IA.