TABLE 4

Oligonucleotides used for PCRs

Primer no.OligonucleotideaSequenceb (5′ to 3′)Amplified region
1F-nrdEGAAGCTTCGGCACATCTAAAGAnt −47 to 290 relative to translational start codon of nrdE
2R-nrdECGCCGCGGCACTCATGAAGGAAG
3F-ytcG-USCGCCGCGGCACTCATGAAGGAAGnt −367 to −22 relative to translational start codon of ytcG
4R-ytcG-USCGGTCGACCCCAACTATATCGTTCCCG
5F-ytcG-DSGCGGATCCGCTAAGAGGATTCTTCTAGCnt +23 to +365 relative to translational stop codon of ytcG
6R-ytcG-DSGCGAGCTCCCTGTTTTCCTGATGGATCGT
7F-ytcGGGATCCAAATGTCCTTCATGCCAnt 179 to 456 of ytcG open reading frame
8R-ytcGGAATTCCTCTTTCTTTATTAAGTC
9F-hisCGCAGGCCTTCAGCAGTATTATGATnt 840 to +71 relative to translational stop codon of hisC
10R-hisCGACCGGCGAGCAATATTGTATCTTTCA
11F-metBATCCCAAGCACACACACGCCGnt 210 to 516 of metB open reading frame
12R-metBAACGGTATGTTCGAACACACCGAAGAT
13F-leuCCGCTTCCAGGGAAAACGATTGnt 353 to 655 of leuC open reading frame
14R-leuCCGATGGATGAACGAATGACTG
15F-nrdEGCTGCAGGCATCTCAAGTTTnt 1155 to 1344 of nrdE open reading frame
16R-nrdECGCATTACGGATGTCTGTTG
17F-vegTGGCGAAGACGTTGTCCGATATTAnt 2 to 83 of veg open reading frame
18R-vegCGGCCACCGTTTGCTTTTAAC
  • a F, forward; R, reverse.

  • b Underlining indicates the following restriction sites: primers 1 and 3, HindII; primer 2, SacII; primer 4, SalI; primers 5 and 7, BamHI; primer 6, SacI; and primer 8, EcoRI.