TABLE 2

Primers used in this study

PrimerNucleotide sequencea (5′–3′)
BF1CAACAGCTCACCTACTTGA
BR3tagKmGGGTACCGAGCTCGAATTCTCATGTTTGTCTCTTCCCC
BF7tagKmGGGGATCCTCTAGAGTCAAAAGCTCAAGGCCTTTTATAGG
BR1AGTATCTTGGCCCTGCTTA
AF4TTGCGCGCTCATCTTTAAC
BR5tagCmCGACGACGGAATGGGATATTTAGAAGGCGTAGCCATAGA
BF6tagCmCAGTTTGTCGCACTGATAAAAGCTCAAGGCCTTTTATAGG
BR6GAATGGCTTTAAATTTTGTTTCAT
BF10ATGAAACAAAATTTAAAGCCATTC
BR7CGGATACAAATCAATCAAATTGC
BF11GCAATTTGATTGATTTGTATCCG
BR8GGTGTTGTTGTTGCCTTGAA
BF2TTCAAGGCAACAACAACACC
BRFLAGTTACTACTTATCGTCGTCATCCTTATAATCAATATCATGATCTTTATAATCACCATCATGATCTTTATAATCGAAGGCGTAGCCATAGAC
CmFFLAGtagGGATGACGACGATAAGTAGTAAGTGGATAGATTTATGATATAATGAG
KmFGAGCTCGGTACCCGGGTGA
KmRGACTCTAGAGGATCCCCG
CmFATATCCCATTCCGTCGTCG
CmRATCAGTGCGACAAACTGGG
CmRKmintagTGCTCCAGCCATCATGCCGATCAGTGCGACAAACTG
KmFinCGGCATGATGGCTGGAGCA
BF2TTCAAGGCAACAACAACACC
BR2AATCCCACCCGCTTGGTT
Hp16SFGAAGATAATGACGGTATCTAAC
Hp16SRATTTCACACCTGACTAT
  • a Tag sequence sites are underlined, and 3× FLAG sequences are shown in boldface.