TABLE 1.

Genes whose expression was identified as being QS regulated by using microarraysa

ORF or intergenic region (ig)Gene nameChange in PAO-JP2 (induced to uninduced) (fold)bGrowth stagecProtein descriptiondlas boxe
QS-promoted genes
    PA00526.7ESHypothetical protein
    PA0105coxB5.7ESCytochrome c oxidase subunit IIACCTGGCTGATCTGATAGCC (R) (−456 to −437)
    PA01076.1ESConserved hypothetical protein
    PA012229ESConserved hypothetical proteinGCCTACCAGATCTGGCAGGC (D), GCCTGCCAGATCTGGTAGGC (R) (−166 to −147)
    PA014417ESHypothetical protein
    PA03995.2MLCystathionine beta-synthase
    PA0447gcdH7.8MLGlutaryl-coenzyme A dehydrogenase
    PA05727.8BHypothetical protein
    PA05887.4MLConserved hypothetical protein
    PA07447.0MLProbable enoyl-coenzyme A hydratase/isomerase
    PA07458.2MLProbable enoyl-coenzyme A hydratase/isomerase
    PA0852fcpbD18ESChitin-binding protein CbpD precursor
    PA09975.9BHypothetical protein
    PA09987.2BHypothetical protein
    PA0999fabH15.1B3-Oxoacyl-(acyl carrier protein) synthase III
    PA1130f7.4BHypothetical protein
    PA1131f5.4BProbable MFS transporter
    PA12126.9ESProbable MFS transporter
    PA12145.0ESHypothetical proteinTCCTGGGTGTTCAGCCAGCC (D) (−381 to −362)
    PA121730ESProbable 2-isopropylmalate synthaseGCCTACCCGATGTTCAAGTG (D) (−438 to −419)
    PA12195.3ESHypothetical protein
    PA1246aprD6.3MLAlkaline protease secretion protein AprD
    PA1249faprA6.9BAlkaline metalloproteinase precursor
    PA1250aprI12BAlkaline proteinase inhibitor AprI
    PA1318cyoB5.7ESCytochrome o ubiquinol oxidase subunit I
    PA1431f,grsaL7.7BRegulatory protein RsaLAACTAGCAAATGAGATAGAT (D) (−77 to −58)h
    PA16576.6MLConserved hypothetical protein
    PA17847.3ESHypothetical proteinCCCTATCCGTTCTGGGAGCT (R) (−140 to −121)
    PA1869f79BProbable acyl carrier proteinCACTGCCAGATCTGGCAGTT (D), AACTGCCAGATCTGGCAGTG (R) (−90 to −71)
    PA1871flasA29ESLasA protease precursor
    PA18749.9ESHypothetical protein
    PA18759.1ESHypothetical protein
    PA1894f25ESHypothetical protein
    PA189511ESHypothetical protein
    PA1896f11ESHypothetical protein
    PA1897g33BHypothetical proteinACCTGCCCGGAAGGGCAGGT (D), ACCTGCCCGGAAGGGCAGGT (R) (−288 to −269)
    PA1901f16ESPhenazine biosynthesis protein PhzC
    PA190242ESPhenazine biosynthesis protein PhzD
    PA190326BPhenazine biosynthesis protein PhzE
    PA190451BProbable phenazine biosynthesis protein
    PA190522BProbable pyridoxamine 5-phosphate oxidase
    PA1927metE20ESMethyltetrahydropteroyltriglutamate-homocysteine S-methyltransferase
    PA199932MLProbable coenzyme A transferase subunit A
    PA200046MLProbable coenzyme A transferase subunit B
    PA2001atoB23MLAcetyl-coenzyme A acetyltransferase
    PA20147.5MLProbable acyl-coenzyme A carboxyltransferase beta chain
    PA20307.3BHypothetical protein
    PA20688.6ESProbable MFS transporter
    PA20698.8ESProbable carbamoyl transferaseGCCTGCGAAATCTGGCAGGG (D) (−109 to −90)
    PA2193fhcnA210BHydrogen cyanide synthase HcnAACCTACCAGAATTGGCAGGG (D), CCCTGCCAATTCTGGTAGGT (R) (−112 to −93)h
    PA2194fhcnB52BHydrogen cyanide synthase HcnB
    PA2195hcnC30BHydrogen cyanide synthase HcnC
    PA21965.3MLProbable transcriptional regulator
    PA2250lpdV7.8MLLipoamide dehydroger ase-Val
    PA2300chiC5.1ESChitinaseACCTACCACAATTGGCAGAG (D) (−193 to −174)
    PA2302f27ESProbable nonribosomal peptide synthetase
    PA230310BHypothetical protein
    PA230414ESHypothetical protein
    PA230528BProbable nonribosomal peptide synthetase
    PA230613ESConserved hypothetica protein
    PA23319.4ESHypothetical protein
    PA23667.5ESConserved hypothetical protein/PICK>
    PA23676.3ESHypothetical protein
    PA242312BHypothetical protein
    PA255210MLProbable acyl-coenzyme A dehydrogenase
    PA255314MLProbable acyl-coenzyme A thiolase
    PA255411MLProbable short-chain dehydrogenase
    PA25556.2MLProbable AMP-binding enzyme
    PA256411ESHypothetical protein
    PA25655.5ESHypothetical protein
    PA256610ESConserved hypothetical proteinCCCTGCCAGTTCTGGTAGGC (D), GCCTACCAGAACTGGCAGGG (R) (−157 to −138)
    PA2570fpalL60ESPA-I galactophilic lectin
    PA2587f16BProbable FAD-dependent monooxygenaseCCCTATCAGAAGATCGAGTT (D) (−126 to −107)
    PA25886.9BProbable transcriptional regulator
    PA2591f5.7BProbable transcriptional regulatorAACTACCAGTTCTGGTAGGT (D) (−115 to −96)
    PA2592f,g5.6BProbable periplasmic spermidine-putrescine- binding proteinAACTACCAGTTCTGGTAGGT (D) (−59 to −40)
    PA293916ESProbable aminopeptidase
    PA3032fsnr-110BCytochrome c
    PA3326f8.7BProbable Clp family ATP-dependent proteaseACCTAACAGATTTGTAAGTT (D) (−241 to −222)
    PA3328f15ESProbable FAD-dependent monooxygenase
    PA3329f55ESHypothetical protein
    PA3330f38MLProbable short-chain dehydrogenase
    PA3331f16BCytochrome P450
    PA333215BConserved hypothetical protein
    PA3333ffabH232B3-Oxoacyl-(acyl carrier protein) synthase III
    PA333423BProbable acyl carrier protein
    PA33355.1BHypothetical protein
    PA336151ESHypothetical protein
    PA3477frhlR5.9ESTranscriptional regulator RhlR
    PA3478frhlB37ESRhamnosyltransferase chain B
    PA3479frhlA100ESRhamnosyltransferase chain ATCCTGTGAAATCTGGCAGTT (D) (−288 to −269)h
    PA351916ESHypothetical protein
    PA352070ESHypothetical protein
    PA37095.2MLProbable MFS transporter
    PA37215.8ESProbable transcriptional regulator
    PA3724flasB39BElastase LasBACCTGCCAGTTCTGGCAGGT (D), ACCTGCCAGTTCTGGCAGGT (R) (−194 to −175)h
    PA390418MLHypothetical protein
    PA39065.8BHypothetical protein
    PA39085.9BHypothetical protein
    PA392312MLHypothetical protein
    PA4078f7.6ESProbable nonribosomal peptide synthetase
    PA412914BHypothetical protein
    PA413012BProbable sulfite or nitrite reductase
    PA41316.8ESProbable iron-sulfur protein
    PA41328.1ESConserved hypothetical protein
    PA413346ESCytochrome c oxidase subunit (cbb3 type)
    PA413422ESHypothetical protein
    PA414125BHypothetical protein
    PA41429.6BProbable secretion protein
    PA41755.5ESProbable endoproteinase Arg-C precursor
    PA4205mexG8.0ESHypothetical protein
    PA4206mexH5.5ESProbable RND efflux membrane fusion protein precursor
    PA4207fmexI6.2ESProbable RND efflux transporter
    PA4208opmD6.2ESProbable outer membrane efflux protein precursor
    PA420914BProbable O-methyltransferaseACCTACCAGATCTTGTAGTT (D) (−327 to −308)
    PA421174BProbable phenazine biosynthesis protein
    PA4217f19ESProbable FAD-dependent monooxygenase
    PA42936.6ESProbable two-component sensor
    PA42948.6ESHypothetical protein
    PA42977.5ESHypothetical proteinGCCTGGCTGGCCATCCAGGC (R) (−190 to −171)
    PA42986.8ESHypothetical protein
    PA42998.9ESHypothetical protein
    PA43007.7ESHypothetical protein
    PA43029.6ESProbable type II secretion system protein
    PA43035.2ESHypothetical protein
    PA43046.7ESProbable type II secretion system protein
    PA43057.3ESHypothetical protein
    PA430628ESHypothetical protein
    PA449610MLProbable binding protein component of ABC transporter
    PA464814ESHypothetical protein
    PA46518.8ESProbable pilus assembly chaperone
    PA467715BHypothetical protein
    PA48788.8BProbable transcriptional regulator
    PA505911ESProbable transcriptional regulator
    PA522019MLHypothetical protein
    ig 4713795-471309847ESIntergenic region between PA4280 and PA4281, 4713098-4713795, (−) strand
QS-repressed genes
    PA00405.6ESConserved hypothetical protein
    PA0509nirN4.7ESProbable c-type cytochrome
    PA05104.1ESProbable uroporphyrin-III c-methyltransferase
    PA05123.2ESConserved hypothetical protein
    PA07143.2ESHypothetical protein
    PA19786.1ESProbable transcriptional regulator
    PA1983exaB12ESCytochrome c550
    PA19845.5ESProbable aldehyde dehydrogenase
    PA2259ptxS3.6MLTranscriptional regulator PtxS
    PA226013MLHypothetical protein
    PA226118MLProbable 2-ketogluconate kinase
    PA23213.2MLGluconokinase
    PA25394.5MLConserved hypothetical protein
    PA25403.0MLConserved hypothetical protein
    PA27113.0ESProbable periplasmic spermidine-putrescine- binding protein
    PA2903cobJ3.3MLPrecorrin-3 methylase CobJ
    PA3391nosR3.0ESRegulatory protein NosR
    PA3392nosZ3.8ESNitrous oxide reductase precursorTACTGCCTCGACTGCCAGAT (D) (−168 to −149)
    PA3393nosD3.5ESNosD protein
    PA3394nosF4.4ESNosF protein
    PA3395nosY4.8ESNosY protein
    PA3396nosL4.3ESNosL protein
    PA36624.6ESHypothetical protein
    PA3870moaA15.1ESMolybdopterin biosynthetic protein A1
    PA38716.4BProbable peptidyl-prolyl cis-trans isomerase, PpiC type
    PA3872narI6.1ESRespiratory nitrate reductase gamma chain
    PA3873narJ6.1BRespiratory nitrate reductase delta chain
    PA3874narH8.5ESRespiratory nitrate reductase beta chain
    PA3875narG8.3ESRespiratory nitrate reductase alpha chain
    PA3876narK211ESNitrite extrusion protein 2
    PA3877narK113ESNitrite extrusion protein 1ATCTGTCCCGCTGGTCAGCG (R) (−217 to −198 in ORF of narX)
    PA39113.7ESConserved hypothetical protein
    PA39125.1ESConserved hypothetical protein
    PA39136.5ESProbable protease
    PA3914moeAI6.9ESMolybdenum cofactor biosynthetic protein A1
    PA3916moaE7.5ESMolybdopterin converting factor large subunit
    PA3917moaD8.0ESMolybdopterin converting factor small subunit
    PA3918moaC6.1ESMolybdopterin biosynthetic protein C
    PA4587ccpR3.9ESCytochrome c551 peroxidase precursor
    PA4628lysP3.4MLLysine-specific permease
    PA49183.0MLHypothetical protein
    ig 2923366-29225686.4MLIntergenic region between PA2587 and PA2588, 2922568-2923366, (−) strand
  • a Only genes identified as being QS regulated that were differentially expressed with a magnitude of change of ≥5-fold (QS promoted) or of ≥3-fold (QS repressed) are included. A list of all genes identified as being QS regulated exhibiting a statistically significant change (P ≤ 0.05) is available online (http://www.urmc.rochester.edu/smd/mbi/bhi/). Genes are identified by ORF designation, gene name, and protein description (http://www.pseudomonas.com).

  • b The magnitude of transcript induction was calculated for PAO-JP2 grown with exogenous autoinducers (1 μM 3O-C12-HSL and 2 μM C4-HSL) compared to PAO-JP2 cultures grown aerobically in modified FAB. The values are reported for the early stationary phase when differential expression was observed in both gr

  • c Growth stage(s) during which statistically significant differential transcript expression (P ≤ 0.05) was exhibited. ML, mid-logarithmic phase; ES, early stationary phase; B, both mid-logarithmic and early stationary phases.

  • d FAD, flavin adenine dinucleotide; RND, resistance-nodulation-cell division; MFS, major facilitator superfamily; ABC, ATP-binding cassette.

  • e The orientation of the consensus sequence is indicated in parentheses (D, directly upstream of the ORF; R, opposite strand). The numbers in parentheses are sequence positions.

  • f Gene previously identified as being QS regulated (4, 8, 18, 27-29, 38, 39, 44).

  • g Gene possessing overlapping las boxes upstream of adjacent ORFs of currently identified QS-regulated genes.

  • h The las box that was directly upstream of the ORF was previously confirmed experimentally (11, 29, 43).